![]() |
union |
Please help by correcting and extending the Wiki pages.
union reads in several sequences, concatenates them and writes them out as a single sequence. The input is typically a list file containing references to multiple sequences or subsequences (regions of a sequence). Optionally, feature information will be used.
The file 'cds.list' contains a list of the regions making up the coding sequence of 'embl:x65923':
% union Concatenate multiple sequences into a single sequence Input (gapped) sequence(s): @cds.list output sequence [x65921.fasta]: |
Go to the input files for this example
Go to the output files for this example
Standard (Mandatory) qualifiers: [-sequence] seqall (Gapped) sequence(s) filename and optional format, or reference (input USA) [-outseq] seqout [ |
Standard (Mandatory) qualifiers | Allowed values | Default | |
---|---|---|---|
[-sequence] (Parameter 1) |
(Gapped) sequence(s) filename and optional format, or reference (input USA) | Readable sequence(s) | Required |
[-outseq] (Parameter 2) |
Sequence filename and optional format (output USA) | Writeable sequence | <*>.format |
Additional (Optional) qualifiers | Allowed values | Default | |
-overlapfile | Sequence overlaps output file (optional) | Output file | <*>.union |
Advanced (Unprompted) qualifiers | Allowed values | Default | |
-feature | Use feature information | Boolean value Yes/No | No |
-source | Create source features | Boolean value Yes/No | No |
-findoverlap | Look for overlaps when joining | Boolean value Yes/No | No |
tembl-id:X65921[782:856] tembl-id:X65921[951:1095] tembl-id:X65921[1557:1612] tembl-id:X65921[1787:1912] |
You may find the program yank useful for creating List files.
>X65921 X65921.1 H.sapiens fau 1 gene atgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacg gtcgcccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtc gtgctcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggag gccctgactaccctggaagtagcaggccgcatgcttggaggtaaagtccatggttccctg gcccgtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaag aagaagacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtg cccacctttggcaagaagaagggccccaatgccaactcttaa |
The result is a normal sequence file containing a single sequence resulting from the concatenation of the input sequences.
union is most useful when the input sequences are specified in a "list file". A list file contain references to any number of sequences which are retrieved from some other file or database. Each sequence reference is a Uniform Sequence Address (USA) which can include the specification of sub-regions of the sequence, eg. em:x65923[20:55]). Specifying several such subregions in a sequence or sequences allows you to enter disjoint sequences to be joined.
Program name | Description |
---|---|
aligncopy | Reads and writes alignments |
aligncopypair | Reads and writes pairs from alignments |
biosed | Replace or delete sequence sections |
codcopy | Copy and reformat a codon usage table |
cutseq | Removes a section from a sequence |
degapseq | Removes non-alphabetic (e.g. gap) characters from sequences |
descseq | Alter the name or description of a sequence |
entret | Retrieves sequence entries from flatfile databases and files |
extractalign | Extract regions from a sequence alignment |
extractfeat | Extract features from sequence(s) |
extractseq | Extract regions from a sequence |
featcopy | Reads and writes a feature table |
featreport | Reads and writes a feature table |
listor | Write a list file of the logical OR of two sets of sequences |
makenucseq | Create random nucleotide sequences |
makeprotseq | Create random protein sequences |
maskambignuc | Masks all ambiguity characters in nucleotide sequences with N |
maskambigprot | Masks all ambiguity characters in protein sequences with X |
maskfeat | Write a sequence with masked features |
maskseq | Write a sequence with masked regions |
newseq | Create a sequence file from a typed-in sequence |
nohtml | Remove mark-up (e.g. HTML tags) from an ASCII text file |
noreturn | Remove carriage return from ASCII files |
nospace | Remove all whitespace from an ASCII text file |
notab | Replace tabs with spaces in an ASCII text file |
notseq | Write to file a subset of an input stream of sequences |
nthseq | Write to file a single sequence from an input stream of sequences |
nthseqset | Reads and writes (returns) one set of sequences from many |
pasteseq | Insert one sequence into another |
revseq | Reverse and complement a nucleotide sequence |
seqret | Reads and writes (returns) sequences |
seqretsetall | Reads and writes (returns) many sets of sequences |
seqretsplit | Reads sequences and writes them to individual files |
sizeseq | Sort sequences by size |
skipredundant | Remove redundant sequences from an input set |
skipseq | Reads and writes (returns) sequences, skipping first few |
splitsource | Split sequence(s) into original source sequences |
splitter | Split sequence(s) into smaller sequences |
trimest | Remove poly-A tails from nucleotide sequences |
trimseq | Remove unwanted characters from start and end of sequence(s) |
trimspace | Remove extra whitespace from an ASCII text file |
vectorstrip | Removes vectors from the ends of nucleotide sequence(s) |
yank | Add a sequence reference (a full USA) to a list file |
You may find the program yank useful for creating List files.